ⓘ Free online encyclopedia. Did you know? page 106



                                               

Nucleic acid structure prediction

Nucleic acid structure prediction is a computational method to determine secondary and tertiary nucleic acid structure from its sequence. Secondary structure can be predicted from one or several nucleic acid sequences. Tertiary structure can be p ...

                                               

Nussinov plots

RNA and tRNA generally has a complex two-dimensional structure. Ruth Nussinov realized that there was a simple way to reveal the structure of RNA and tRNA. The methodology is to create a circle. Each base is numbered. If there are "n" bases, then ...

                                               

Partition function for Interacting RNAs

Partition function for Interacting RNAs is a parallel C++ package to compute joint and individual partition functions for two RNA sequences. From the partition functions, piRNA computes equilibrium concentrations of single and double species, ens ...

                                               

Piwi-interacting RNA

Piwi-interacting RNA is the largest class of small non-coding RNA molecules expressed in animal cells. piRNAs form RNA-protein complexes through interactions with piwi-subfamily Argonaute proteins. These piRNA complexes are mostly involved in the ...

                                               

Preribosomal RNA

Preribosomal RNA represents a small class of RNA that is copied from DNA representing the genome sequence. However the pre-rRNA cannot be used for protein production until splicing of the introns occurs, forming a new bond between the exons and r ...

                                               

Pseudoknot

A pseudoknot is a nucleic acid secondary structure containing at least two stem-loop structures in which half of one stem is intercalated between the two halves of another stem. The pseudoknot was first recognized in the turnip yellow mosaic viru ...

                                               

Pseudomonas sRNA

Pseudomonas sRNA are non-coding RNAs that were predicted by the bioinformatic program SRNApredict2. This program identifies putative sRNAs by searching for co-localization of genetic features commonly associated with sRNA-encoding genes and the e ...

                                               

Purine riboswitch

A purine riboswitch is a sequence of ribonucleotides in certain messenger RNA that selectively binds to purine ligands via a natural aptamer domain. This binding causes a conformational change in the mRNA that can affect translation by revealing ...

                                               

Ribonucleotide

In biochemistry, a ribonucleotide is a nucleotide containing ribose as its pentose component. It is considered a molecular precursor of nucleic acids. Nucleotides are the basic building blocks of DNA and RNA. The monomer itself from ribonucleotid ...

                                               

Riboregulator

In molecular biology, a riboregulator is a ribonucleic acid that responds to a signal nucleic acid molecule by Watson-Crick base pairing. A riboregulator may respond to a signal molecule in any number of manners including, translation of the RNA ...

                                               

Riboswitch

In molecular biology, a riboswitch is a regulatory segment of a messenger RNA molecule that binds a small molecule, resulting in a change in production of the proteins encoded by the mRNA. Thus, an mRNA that contains a riboswitch is directly invo ...

                                               

RNA hydrolysis

RNA hydrolysis is a reaction in which a phosphodiester bond in the sugar-phosphate backbone of RNA is broken, cleaving the RNA molecule. RNA is susceptible to this base-catalyzed hydrolysis because the ribose sugar in RNA has a hydroxyl group at ...

                                               

RNA transfection

RNA transfection is the process of deliberately introducing RNA into a living cell. RNA can be purified from cells after lysis or synthesized from free nucleotides either chemically, or enzymatically using an RNA polymerase to transcribe a DNA te ...

                                               

RNA-induced silencing complex

The RNA-induced silencing complex, or RISC, is a multiprotein complex, specifically a ribonucleoprotein, which incorporates one strand of a single-stranded RNA fragment, such as microRNA, or double-stranded small interfering RNA. The single stran ...

                                               

RNAs present in environmental samples

A wide variety of non-coding RNAs have been identified in various species of organisms known to science. However, RNAs have also been identified in "metagenomics" sequences derived from samples of DNA or RNA extracted from the environment, which ...

                                               

RsaOG

RsaOG is a non-coding RNA that was discovered in the pathogenic bacteria Staphylococcus aureus N315 using a large scale computational screening based on phylogenetic profiling. It was first identified, but not named, in 2005. RsaOG has since been ...

                                               

SbRNA

sbRNA is a family of non-coding RNA first discovered in Caenorhabditis elegans. It was identified during a full transcriptome screen of the C. elegans cDNA library. Subsequent experimentation characterised sbRNA as having conserved 5 and 3 intern ...

                                               

Short hairpin RNA

A short hairpin RNA or small hairpin RNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference. Expression of shRNA in cells is typically accomplished by delivery of plasmi ...

                                               

Small nucleolar RNA-derived microRNA

In molecular biology, small nucleolar RNA derived microRNAs are microRNAs derived from small nucleolar RNA. MicroRNAs are usually derived from precursors known as pre-miRNAs, these pre-miRNAs are recognised and cleaved from a pri-miRNA precursor ...

                                               

SR1 RNA

In molecular biology, the SR1 RNA is a small RNA produced by species of Bacillus and closely related bacteria. It is a dual-function RNA which acts both as a protein-coding RNA and as a regulatory sRNA. SR1 RNA is involved in the regulation of ar ...

                                               

SRNA-Xcc1

sRNA-Xcc1 is a family of trans-acting non-coding RNA. Homologs of sRNA-Xcc1 are found in a few bacterial strains belonging to alpha-proteobacteria, beta-proteobacteria, gamma-proteobacteria, and delta-proteobacteria. In Xanthomonas campestris pv. ...

                                               

Streptococcus sRNA

In molecular biology, Streptococcus sRNAs are small RNAs produced by species of Streptococcus bacteria. Several screens have identified numerous sRNAs in different species and strains of Streptococcus including S. pneumoniae, S. pyogenes, S. agal ...

                                               

Subgenomic mRNA

During transcription, the original template strand is usually read from the 3 to the 5 end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3 end of the template strand or 5 of the to-be-newly synthesized templ ...

                                               

T7 RNA polymerase

The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5’ * 3 T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------ ...

                                               

TeloSII ncRNAs

TeloSII non-coding RNAs were discovered by selecting Telo and SII element containing sequences in a whole genome screening in Arabidopsis. These elements have been shown to coordinate the expression of protein-coding genes related to ribosome bio ...

                                               

Tobacco mosaic virus memory

The Tobacco Mosaic Virus is an extremely common helical virus, with a positive sense RNA strand. In recent years, researchers have found that this virus can be utilized to create nano wires using platinum nanoparticles. Tseng et al. have discover ...

                                               

Trypanosome H/ACA box snoRNAs

Non-coding RNAs are RNA molecules that have a function but are not translated into proteins. Small nucleolar RNAs, one of the largest classes of ncRNA, are further subdivided into the two major C/D and H/ACA snoRNA families. snoRNA serve as guide ...

                                               

Ure2 internal ribosome entry site (IRES)

In molecular biology, the Ure2 internal ribosome entry site is an RNA element present in the 5 UTR of the mRNA of Ure2. It allows 5 cap- and eIF4E-independent translation of an N-terminally truncated form of Ure2. This truncated form lacks the pr ...

                                               

Vibrio cholerae ToxT activated RNAs

In molecular biology, Vibrio cholerae ToxT activated RNAs are small RNAs which are produced by the bacterium Vibrio cholerae. They are regulated by the transcriptional activator ToxT and may play a role in V. cholerae virulence. Two ToxT activate ...

                                               

VR-RNA

In molecular biology, VR-RNA is a small RNA produced by Clostridium perfringens. It functions as a regulator of the two-component VirR/VirS system. VR-RNA regulates numerous genes including: Arginine deiminase ADI pathway genes Extracellular nucl ...

                                               

Xanthomonas sRNA

In molecular biology, Xanthomonas sRNA are small RNAs which have been identified in various species of the bacterium Xanthomonas. Analysis of the plant pathogen Xanthomonas campestris pv. vesicatoria revealed expression of seven cis-encoded antis ...

                                               

Z-RNA

Z-RNA is a left-handed alternative conformation for the RNA double helix. Just like for Z-DNA, Z-RNA is favored by a sequence composed of Purine/Pyrimidine repeats and especially CG repeats.

                                               

Antisense RNA

                                               

Cis-regulatory RNA elements

                                               

Internal ribosome entry site

                                               

MicroRNA

                                               

Non-coding RNA

                                               

Riboswitch

                                               

RNA interference

                                               

RNA splicing

                                               

Small nuclear RNA

                                               

Spliceosome

                                               

Cymodoceaceae

Cymodoceaceae is a family of flowering plants, sometimes known as the "manatee-grass family", which includes only marine species. The 2016 APG IV does recognize Cymodoceaceae and places it in the order Alismatales, in the clade monocots. The fami ...

                                               

Thalassodendron ciliatum

Thalassodendron ciliatum has a wide distribution throughout the Indo-Pacific region, but has variable abundances throughout its range. This seagrass has been recorded from the western Philippines to Borneo and Singapore, Indonesia, Papua New Guin ...

                                               

Halophila

Halophila is a genus of seagrasses in the family Hydrocharitaceae, the tape-grasses. It was described as a genus in 1806. The number of its contained species, and its own placement in the order Alismatales, has evolved. It is widespread in tropic ...

                                               

Halophila engelmannii

Halophila engelmannii, commonly known as star grass and Engelmanns seagrass, is a flowering plant, a seagrass in the family Hydrocharitaceae. It grows underwater on sandy or muddy sea floors in shallow parts of the Gulf of Mexico and the Caribbea ...

                                               

Posidonia

Posidonia is a genus of flowering plants. It contains nine species of marine plants, found in the seas of the Mediterranean and around the south coast of Australia. The APG system 1998 and APG II system 2003 accept this genus as constituting the ...

                                               

Posidonia robertsoniae

A species of Posidonia, submerged flowering plants found in mediterraean climates. A perennial rhizomatous herb that appears as stands in marine habitat. This species is found at depths from 0.5 to 20 metres on white sands, in coastal waters that ...

                                               

Zosteraceae

Zosteraceae is a family of marine perennial flowering plants found in temperate and subtropical coastal waters, with the highest diversity located around Korea and Japan. Most seagrasses complete their entire life cycle under water, having filame ...

                                               

Phyllospadix

Free and no ads
no need to download or install

Pino - logical board game which is based on tactics and strategy. In general this is a remix of chess, checkers and corners. The game develops imagination, concentration, teaches how to solve tasks, plan their own actions and of course to think logically. It does not matter how much pieces you have, the main thing is how they are placement!

online intellectual game →